Mira en cámara lenta cómo se hace un tatuaje y por qué duele tanto

BadabunNetworkBadabun NetworkBunYoutubersredsocialtatuajeartedragon balldragon ball zanime

Google+► https://plus.google.com/+badabunOficial
Suscríbete► https://www.youtube.com/user/badabunOficial?sub_confirmation=1
Facebook► https://www.facebook.com/BadabunOficial
Twitter► https://twitter.com/BadabunOficial
Instagram https://instagram.com/badabunoficial
Sitio Web► http://www.badabun.net/

CONTACTO► contacto@badabun.com

BADABUN NETWORK ©

"VOZ" por Victor González
Facebook► https://www.facebook.com/VictorGonzalezOficial
Youtube► https://www.youtube.com/c/victorgonzalezoficial
Twitter► https://twitter.com/VictorGOfficial 
Instagram► https://instagram.com/VictorGOfficial

Andrea de Adexe Gutierrez Hernandez
Fuck pensaba en hacerme uno ahora ya no
Cr Cactus
wtf?! vegeta sonriendo???
Cheneque 125
Alguien q sepa como se llama la rola?
mich mar
wtf??? eso fue más rápido que nada solo como 5 segundos mostraron lo de cámara lenta ....y si alguien entendió espliqueis
carolina RIVERA
like si quieres el tatuaje de Vegeta pero no tienes dinero o eres menor de edad o sientes que te va a doler :v
soy karolista
Y yo que pensé hacerme un tatuaje:v
Esperanza Rico
obiamente duele por que es una aguja,algo k se te introduce a tu cuerpo
Desireé Bon
Yo nunca me haré un tatuaje después cuando me haga vieja se hará todo feo pero respeto el gusto de cada quien
Trebor Sky
Hayyyy ese vegeta está orrible
EliandroGP
mejor vegeta que el nombre de un@ novi@
canal:camilindos/as :v
me gustó de grande me are el tatuaje más bonito
Nayele Rodrigea
no mamches no savia que tambien se podían aser tatuages en el ojo
Geovanni Ander
esta padre y todo pero lo mas pendejo es tatuarse a un vegeta :v
Fernando Acosta
una vérgetta..jaja
Luna Crespin
dejo mi like por el dios vegetta 😎
Roberto Bueno
Tatuajes versión gay :v
Dono taku
tiene marca de agua el video no es de badabun
EME ZETA
y donde quedó la cámara lenta. que porquería DISLIKE y vídeo flagged
London Girls
De seguro el chavo que se tatuo eso se arrepintió al dia siguiente😂😂 esta vien feote el veggeta,vegetta vegeta como se ezcriva (escriba) pero yo diria: no te pases we lo hisistes bien feote we!!😂😂😂
Gabriel Mayorca del Razo
Q HORRENDO TATUAJE Q ASCO
kuqueits material pop
o Dios eso deve doler muchisimo
un tipo
el tatuaje mas feo que eh visto xDxD!! watafac vegeta con flores?? no mamen xD
Manuel Alexis Hernandez Gonzalez
vegeta tenia una ceja azul y otra negra
douglas XDax
yo prefiero todo negro no con colores el tatuaje
Juana De La Rosa Llafquen Maliqueo
el tipo q se iso el tatuaje es amigo de mi hijo 👌
Desire_ Martinez
yo llo que pensaba todo él vídeo era, En serio se a tatuado a Goku!?
Ruben Aguirre Reyes Jr
Hay Que Horror
Erika Brito
No duelen -.-
nicolas lopretti
un desastre la nariz de vegeta
Patito Pato
El video no ayuda mucho, Solo me provocó sida
tu carita feliz
lento y ql prinsipio camara rapida
EL PRO DE LOS VIDEOJUEGOS
shiiiiit
Milagros Lopèz Rosas
un tato no duele no inventen 👌😒 solo son faramallas que dicen pero en vdd no duele 👌solo le duele ah la jente collona y chillona😂👌😒
maybe2012 lopez
ouch 😂😭💔✋
Lizeth Dueñaa
Que pinche asco
mari princess
no lo creo pues yo me voy a ser uno diferente
fernando sosa
porque dice en camara lenta no vi nada solo dos piquetes en camara lenta y el resto fue.rapido
stop motion lego
gggggguuuuuuuuuaaaaaaaauuuuuuuu
MARÍA XD Gamer05
yo nose para que quieren un pinche tatuaje... que le ven de lindo😒
Gastón Villamea
creo que mejor uso los tatuajes del caramelo😅😅
gemelas Avila
a mi no me gustan
Cesar Martinez Bort
Hay
ZeyenYT ._.
Puto clickbait
Fernando M.F.
si solo se ve a camara lenta 2 segundos? que estafa es esta?
Marcelo Calegari
horrible ese vegeta ..
Frankilin Cazgut
jijijijiji
Frankilin Cazgut
duele mas cuando te penetran por el oveder
Respect All Fear None
Ni siquiera duelen los tatuajes para nada solo la gente fragil siente dolor
Alisacarolina Aviles
no le vi el dolor
alan garcia
no mames pinche vegeta todo gay ! se supone que es un personaje rudo ,temerario lleno de ìra ; pinches flores la cagaron y tambien esos colores tan de niñita XD
Related Videos
Thumbnail: Pensó que estaba embarazada, pero luego descubrió que algo aterrador crecía dentro de ella…
Thumbnail: 9 trucos de belleza que puedes hacer con tu desodorante. Te verás más bonita
Thumbnail: Micropigmentación de Labios - Técnicas Avanzadas Goldeneye
Thumbnail: TATUANDO EN VIVO!!!!!!!! simbolo del infinito con nombre y corazon
Thumbnail: Escucharon gritos bajo el pozo. Lo que sacaron prueba que Dios sí existe
Thumbnail: Como se hacen los tatuajes
Thumbnail: GETTING MY FIRST TATTOO!! 😱
Thumbnail: 4 NEW TATTOOS IN 1 DAY!!!!!
Thumbnail: Él hace tatuajes a niños y la razón te encantará | ActitudFEM
Thumbnail: Le llevó flores a su EX. Cuando sepas por qué lo hizo se te hará un nudo en la garganta
Thumbnail: CUIDADO! Arruinó su vida por este estúpido error que todas las mujeres cometen…
Thumbnail: Por error mandó a su padre lo que cobra por una noche y no creerás lo que le respondió
Thumbnail: Best Tattoo in Ultra Slow Motion
Thumbnail: 8 cosas increíbles que un bebé puede hacer dentro del vientre y NO sabías. Son un milagro
Thumbnail: Las nalgadas más ricas que verás en internet. Reto de la semana inglesa
Thumbnail: COMO HACER TATUAJES TEMPORALES CASEROS
Thumbnail: Piernas de Acero
Thumbnail: Ve cómo bombea la piel una máquina de tatuajes en cámara lenta TATOO SLOW MOTION
Thumbnail: 5 formas increíbles de amarrar tus agujetas. Serás la envidia de tu salón
Thumbnail: 10 datos increíbles de Chloë Moretz. Por eso es la mujer más buscada en internet
Thumbnail: D.I.Y. Stick N' Poke Tattoo
Thumbnail: Sacerdote revela lo que le hacía a niños de 6 años. “Los violábamos entre 3 y lo hacíamos…”
Thumbnail: Niño usa técnica especial de Vegeta para sobrevivir a un ataque de 400 abejas….
Thumbnail: El hombre más tatuado del mundo se maquilla
Thumbnail: Asi se hace Sardinas en lata
Thumbnail: 11 super humanos que existen en la vida real. El #6 fue creado por Hitler
Thumbnail: Niña pasó 10 días perdida en el mar, cuando la encontraron pedía que la mataran
Thumbnail: ASI SE HACE EL VIDRIO EN MURANO, VENECIA, ITALIA.
Thumbnail: 10 cosas que has hecho mal toda tu vida. Ahora todo tiene sentido
Thumbnail: Golpes - Ciencia en cámara lenta - Proyecto G
Thumbnail: Mira lo que tu color de labios dice de ti. Los hombres ODIAN el #3
Thumbnail: Descubra cómo se hacen los más espectaculares trucos de magia
Thumbnail: 9 trucos para que tus zapatos siempre luzcan como nuevos
Thumbnail: Mira lo que tus labios dicen de ti y por qué los hombres aman los #4
Thumbnail: Así lucen las protagonistas de “Atrévete a Soñar” 9 años después
Thumbnail: 7 bromas que debes hacer antes de morir. Si no tu vida no habrá valido la pena
Thumbnail: TATUAJES DENTRO DEL OJO. La nueva y estúpida moda del siglo XXI
Thumbnail: J Balvin se borra algunos de su tatuajes y mira lo hace después |Bomba blonw|
Thumbnail: TATUAJE Pensó que no dolía | mega wow 2016
Thumbnail: ESTO PASA CUANDO DECIDES HACERTE UN TATUAJE CON TINTA DE MALA CALIDAD.
Thumbnail: Slowmotion Tattoo HD
Thumbnail: Top 10 tatuajes en 3D
Thumbnail: PERCING: LOS LUGARES MAS LOCOS, ABSURDOS Y DOLOROSOS, DONDE COLOCARLOS
Thumbnail: Joven chileno se tatuó los ojos para parecer calavera - CHV Noticias
Thumbnail: Orale, se quería tatuar...ahora aguantase cabrona!
Thumbnail: Slow Motion Tattoo lines
Thumbnail: Cuidado con los tatuajes mira como evolucionan
Thumbnail: Tatuando en vivo!!!! SU PRIMER TATUAJE
Thumbnail: Top 10 Tatuajes de la Cárcel y Sus Significados
Thumbnail: TATUAJES - LOS PEORES DE LA HISTORIA